Agfdhyk

#!/usr/bin/env python



FILE_NAME = "testprecomb.txt"                       

NR_MATCHING_CHARS = 5                        



lines = set()                                 

with open(FILE_NAME, "r") as inF:            

    for line in inF:                         

        line = line.strip()                 

        if line == "": continue              

        beginOfSequence = line[:NR_MATCHING_CHARS]

        if not (beginOfSequence in lines):  

            print(line)                      

            lines.add(beginOfSequence)        

This is the code I have right now but it is not working. I have a file that has lines of DNA that sometimes start with the same sequence (or pattern of letters). I need to write a code that will find all lines of DNA that start with the same letters (perhaps the same 10 characters) and delete one of the lines.

Example (issue):

CCTGGATGGCTTATATAAGAT***GTTAT***



***GTTAT***ATAATATACCACCGGGCTGCTT



***GTTAT***ATAGTTACAGCGGAGTCTTGTGACTGGCTCGAGTCAAAAT

What I need as result after one is taken out of file:

CCTGGATGGCTTATATAAGAT***GTTAT***



***GTTAT***ATAATATACCACCGGGCTGCTT

(no third line)

I think your set logic is correct. You are just missing the portion that will save the lines you want to write back into the file. I am guessing you tried this with a separate list that you forgot to add here since you are using append somewhere.

FILE_NAME = "sample_file.txt"

NR_MATCHING_CHARS = 5



lines = set()

output_lines =  # keep track of lines you want to keep

with open(FILE_NAME, "r") as inF:

    for line in inF:

        line = line.strip()

        if line == "": continue

        beginOfSequence = line[:NR_MATCHING_CHARS]

        if not (beginOfSequence in lines):

            output_lines.append(line + 'n') # add line to list, newline needed since we will write to file

            lines.add(beginOfSequence)

print output_lines



with open(FILE_NAME, 'w') as f:

    f.writelines(output_lines) # write it out to the file

Your approach has a few problems. First, I would avoid naming file variables inF as this can be confused with inf. Descriptive names are better: testFile for instance. Also testing for empty strings using equality misses a few important edge cases (what if line is None for instance?); use the not keyword instead. As for your actual problem, you're not actually doing anything based on that set membership:

FILE_NAME = "testprecomb.txt"                       

NR_MATCHING_CHARS = 5                        



prefixCache = set()

data = 

with open(FILE_NAME, "r") as testFile:            

    for line in testFile:                         

        line = line.strip()                 

        if not line: 

            continue              

        beginOfSequence = line[:NR_MATCHING_CHARS]

        if (beginOfSequence in prefixCache):

            continue

        else:

            print(line)

            data.append(line)

            prefixCache.add(beginOfSequence)