Haplogroup Q-M242
































Haplogroup Q
Haplogroup Q (Y-DNA).PNG
Possible time of origin 17,200 to 31,700 years ago [1][2][3] (approximately 24,500 years BP)
Possible place of origin
Central Asia,[4][5]South Central Siberia[2]
Ancestor P1-M45
Descendants
Q1 (L232/S432)
Defining mutations M242
Highest frequencies
Kets 93.8%,[6]Turkmens 73%,[7]Selkups 66.4%.,[6]Altaians 63.6%.,[8]Tuvans 62.5%.,[9]Chelkans 60.0%.,[8]Tubalar 41%,[8]Siberian Tatars 38%,[10] Other Turkic peoples, Inuit, the indigenous peoples of the Americas, Akha people of northern Thailand, Mon-Khmer people and some tribes of Assam

Haplogroup Q or Q-M242 is a Y-chromosome DNA haplogroup. It has one primary subclade, Haplogroup Q1 (L232/S432), which includes numerous subclades that have been sampled and identified in males among modern populations.


Q-M242 is the predominant Y-DNA haplogroup among Native Americans and several peoples of Central Asia and Northern Siberia. It is also the predominant Y-DNA of the Akha tribe in northern Thailand and the Dayak people of Indonesia.




Contents






  • 1 Origins


  • 2 Technical specification of mutation


  • 3 Subclades


    • 3.1 Phylogenetic trees


      • 3.1.1 The 2015 ISOGG tree


      • 3.1.2 The Genomic Research Center draft tree


      • 3.1.3 The Y Chromosome Consortium tree




    • 3.2 Phylogenetic variants




  • 4 Distribution


    • 4.1 Americas


      • 4.1.1 North America


      • 4.1.2 Mesoamerica & South America




    • 4.2 Asia


      • 4.2.1 North Asia


      • 4.2.2 East Asia


      • 4.2.3 Southeast Asia


      • 4.2.4 Central Asia


      • 4.2.5 Southwest Asia


      • 4.2.6 South Asia




    • 4.3 Europe


      • 4.3.1 Central- and Eastern Europe


      • 4.3.2 Northern Europe


      • 4.3.3 Western Europe


      • 4.3.4 Southern Europe




    • 4.4 Africa


    • 4.5 Subclade distribution




  • 5 Y-DNA Q samples from ancient sites


  • 6 See also


    • 6.1 Populations


    • 6.2 Y-DNA Q-M242 subclades


    • 6.3 Y-DNA backbone tree




  • 7 References


    • 7.1 Citations


    • 7.2 Bibliography




  • 8 External links





Origins


Haplogroup Q-M242 is one of the two branches of P1-M45 also known as K2b2a (The other is R-M207).


Q-M242 is believed to have arisen around the Altai Mountains area (or South Central Siberia),[2] approximately 17,000[2] to 31,700 years ago.[3] However, the matter remains unclear due to limited sample sizes and changing definitions of Haplogroup Q: early definitions used a combination of the SNPs M242, P36.2, and MEH2 as defining mutations.


Karafet et al. (2014), stated: "rapid diversification process of K-M526 likely occurred in Southeast Asia, with subsequent westward expansions of the ancestors of haplogroups R and Q."[11]



Technical specification of mutation


The technical details of M242 are:



Nucleotide change: C to T

Position (base pair): 180

Total size (base pairs): 366

Forward 5′→ 3′: aactcttgataaaccgtgctg

Reverse 5′→ 3′: tccaatctcaattcatgcctc



Subclades


In Y chromosome phylogenetics, subclades are the branches of a haplogroup. These subclades are also defined by single-nucleotide polymorphisms (SNPs) or unique-event polymorphisms (UEPs). Haplogroup Q-M242, according to the most recent available phylogenetics has between 15 and 21 subclades. The scientific understanding of these subclades has changed rapidly. Many key SNPs and corresponding subclades were unknown to researchers at the time of publication are excluded from even recent research. This makes understanding the meaning of individual migration paths challenging.



Phylogenetic trees


There are several confirmed and proposed phylogenetic trees available for haplogroup Q-M242. The scientifically accepted one is the Y Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that shows emerging science is provided by Thomas Krahn at the Genomic Research Center in Houston, Texas. The International Society of Genetic Genealogy (ISOGG) also provides an amateur tree.



The 2015 ISOGG tree


The subclades of Haplogroup Q-M242 with their defining mutation (s), according to the 2015 ISOGG tree[4] are provided below. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.



  • Q-M242 M242

    • Q-P36.2 P36.2, L232, L273, L274 (Q1)


      • Q-MEH2 MEH2 (Q1a)


        • Q-F1096 F1096, F1215 (Q1a1)


          • Q-NWT01 NWT01 (Q1a1a)

            • Q-M120 M120, M265/N14 (Q1a1a1)



          • Q-M25 M25, M143 (Q1a1b)

            • Q-L712 L712 (Q1a1b1)





        • Q-M346 L56, L57, M346, L528 (Q1a2)


          • Q-L53 L53 (Q1a2a)

            • Q-L54 L54 (Q1a2a1)


              • Q-CTS11969 CTS11969, M930 (Q1a2a1a)


                • Q-M3 M3 (Q1a2a1a1)

                  • Q-M19 M19 (Q1a2a1a1a)



                • Q-L804 L804 (Q1a2a1a2)




              • Q-CTS1780 CTS1780, M981, M971, Z780 (Q1a2a1b)


              • Q-L330 L330 (Q1a2a1c)





          • Q-F835 F835, L940 (Q1a2b)


          • Q-F1161 F1161

            • Q-L527 L527







      • Q-L275 L275, L314 (Q1b)


        • Q-M378 M378/Page100, L214, L215/Page82 (Q1b1)

          • Q-FGC1774 FGC1774, Y2016 (Q1b1a)

            • Q-245 L245 (Q1b1a1)




        • Q-Y1150 Y1150 (Q1b2) (Q1b-L68)







The Genomic Research Center draft tree


Below is a 2012 tree by Thomas Krahn of the Genomic Research Center.[12] The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.[13]



  • P-M45

    • Q-M242 M242
      • P36.2, L232, L273.1, L274.1


        • MEH2, L472, L528


          • M120, N14/M265


          • M25, M143, L714, L716


          • M346, L56, L57, L474, L892, L942

          • P89.1

          • NWT01




        • L275, L314, L606, L612

          • M378, L214, L215







The Y Chromosome Consortium tree


This is the 2008 tree produced by the Y Chromosome Consortium (YCC).[14] Subsequent updates have been quarterly and biannual. The current version is a revision of the 2010 update.[15] The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.



  • P-M45

    • Q-M242 M242

      • Q-P36.2 P36.2


        • Q-MEH2 MEH2



            • Q-M120 M120, N14, M265


            • Q-M25 M25, M143



          • Q-M346 L56, L57, M346

            • Q-P89.1 P89.1





        • Q-L275 L275

          • Q-M378 L214, L215, M378







Phylogenetic variants


The subclade (under Q-MEH2) proposed by Sharma (2007), which shows polymorphism (ss4bp, rs41352448) at 72,314 position of human arylsulfatase D pseudogene, is not represented in any current trees under Q-MEH2.[16] The most plausible explanation for this could be an ancestral migration of individuals bearing Q-MEH2 to the Indian subcontinent followed by an autochthonous differentiation to Q-ss4bp.[5]



Distribution



Americas



Several branches of haplogroup Q-M242 have been predominant pre-Columbian male lineages in indigenous peoples of the Americas. Most of them are descendants of the major founding groups who migrated from Asia into the Americas by crossing the Bering Strait.[2] These small groups of founders must have included men from the Q-M346, Q-L54, Q-Z780, and Q-M3 lineages. In the North America, two other Q-lineages also have been found. These are Q-P89.1 (under Q-MEH2) and Q-NWT01. They may have not been from the Beringia Crossings but instead come from later immigrants who traveled along the shoreline of Far East Asia and then the Americas using boats.


It is unclear whether the current frequency of Q-M242 lineages represents their frequency at the time of immigration or is the result of the shifts in a small founder population over time. Regardless, Q-M242 came to dominate the paternal lineages in the Americas.



North America


In the indigenous people of North America, Q-M242 is found in Na-Dené speakers at an average rate of 68%. The highest frequency is 92.3% in Navajo, followed by 78.1% in Apache,[2] 87%[2] in SC Apache,[17] and about 80% in North American Eskimo (Inuit)–Aleut populations. (Q-M3 occupies 46% among Q in North America)[18]


On the other hand, a 4000-year-old Saqqaq individual belonging to Q1a-MEH2* has been found in Greenland. Surprisingly, he turned out to be genetically more closely related to Far East Siberians such as Koryaks and Chukchi people rather than Native Americans.[19] Today, the frequency of Q runs at 53.7% (122/227: 70 Q-NWT01, 52 Q-M3) in Greenland, showing the highest in east Sermersooq at 82% and the lowest in Qeqqata at 30%.[20]


Q-M242 is estimated to occupy 3.1% of the whole US population in 2010: According to the US National Population Census data (2010),[21] the frequency of White people (xHispaic) is 63.7%, followed by Hispanic 16.3%, Black 12.6%, Asian 4.8%, Native American (mainland and Alaska, not including the Pacific islands) 0.9%, etc. And haplogroup Q frequencies in each population sectors are Q-P36* 0.6% & Q-M3 0.1% in White American, Q-P36* 3.8% & Q-M3 7.9% in Hispanic American, Q-P36* (xM3) 0.2% in African American, Q-P36* 31.2% & Q-M3 26.9% in Native American.[22] So, recalculated by the population weights of each sector, the frequency of Q-M242 in the US reaches 3.1% as of 2010. (This figure will rise up, as Hispanic population in the US increases.)



Mesoamerica & South America


Haplogroup Q-M242 has been found in approximately 94% of Indigenous peoples of Mesoamerica and South America.[23] Q-M242 built many ancient cultures and civilizations such as Tiwanaku, Caral(Norte Chico civilization), Maya, Inca, Aztec, and so on.


As a result of five centuries of wide-scale biological mestizaje, or miscegenation, between indigenous Americans and European immigrants, today in Mesoamerica and South America the frequencies of Q-M242 (mostly M3) among the whole male population of each country are lower than indigenous Amerincan populations, but nonetheless run far higher than in the population of North America.


The frequencies of Q among the whole male population (inclusive of all mixed-race and mono-racial groups) of each country reach as follow:



  • 61% in Bolivia.[24]

  • 51% in Guatemala,[25]

  • 40.1% (159/397)[26] to 50% in Peru

  • 37.6% in Ecuador,[27]

  • 37.3% (181/485) in Mexico[26] (30.8% (203/659) among the specifically Mestizo segment)[28]

  • 31.2% (50/160) in El Salvador,[29]

  • 15.3% (37/242) to 21.8% (89/408) in Panama,[26][30]

  • 16.1% in Colombia,[31]

  • 15.2% (25/165) in Nicaragua,[32]

  • 9.7% (20/206) in Chile,[26]

  • 5.3% (13/246 in 8 provinces in northeastern, central, southern regions)[33] to 23.4% (181/775 in 8 provinces in central-west, central, northwest regions)[34] in Argentina,

  • 5% in Costa Rica,[35]

  • 3.95% in Brazil,[36] and so on.


Based on the data above, the average frequency in the whole male population of Mesoamerica and South America is estimated to be about 18%.



Asia


Q-M242 originated in Asia (Altai regions), and is widely distributed across it.[2] Q-M242 is found in Russia, Siberia (Kets,[6]Selkups, Siberian Yupik people, Nivkhs, Chukchi people,[37]Yukaghirs, Tuvans,[38]Altai people,[8]Koryaks, etc.), Mongolia,[39]China,[40][41]Uyghurs,[39]Tibet,[42]Korea, Japan, Indonesia,[43]Vietnam,[44]Thailand,[45]India,[46]Pakistan,[46]Afghanistan, Iran,[47]Iraq, Saudi Arabia, Turkmenistan, Uzbekistan, and so on. (For details, see below.)



North Asia


In Siberia, the regions between Altai and Lake Baikal, which are famous for many prehistoric cultures and as the most likely birthplace of haplogroup Q, exhibit high frequencies of Q-M242. In a study (Dulik 2012),[48] Q-M242 (mostly Q-M346 including some Q-M3) has been found in 24.3% (46/189: 45 Q-M346, 1 Q-M25) of all Altaian samples. Among them, Chelkans show the highest frequency at 60.0% (15/25: all Q-M346), followed by Tubalars at 41% (11/27: 1 Q-M25, 10 Q-M346) and Altaians-Kizhi at 17% (20/120).
In a former study, Q-M242 is found in 4.2% of southern Altaians and 32.0% of northern Altaians with the highest frequency of 63.6% in Kurmach-Baigol (Baygol). The frequency reaches 13.7% (20/146) in the whole samples.[8] In another study,[49] the frequency rises up to 25.8% (23/89: all Q-M346) in Altaians. Based on the results of these studies, the average frequency of Q-M242 in Altaians is about 21%.


Tuva, which is located on the east side of Altai Republic and west of Lake Baikal as well as on the north side of Mongolia, shows higher frequency of Q-M242. It is found in 14%[50]~38.0% (41/108)[49] of Tuvans. Also, Todjins (Tozhu Tuvans) in eastern Tuva shows the frequency at ≤22.2% (8/36 P(xR1)[51])~38.5% (10/26, all Q-M346(xM3)).[49] So, the average frequency of Q-M242 among Tuvans-Todjins in Tuva Republic is about 25%. Haplogroup Q-M242 has been found in 5.9% (3/51) of a sample of Tuvans from the village of Kanasi, 9.8% (5/51) of a sample of Tuvans from the village of Hemu, and 62.5% (30/48) of a sample of Tuvans from the village of Baihaba in northern Xinjiang near the international border with Altai Republic.[9]


In Siberian Tatars, the Ishtyako-Tokuz sub-group of Tobol-Irtysh group has a frequency of Q-M242 at 38%.[10]


The highest frequencies of Q-M242 in Eurasia are witnessed in Kets (central Siberia) at 93.8% (45/48) and in Selkups (north Siberia) at 66.4% (87/131).[6] Russian ethnographers believe that their ancient places were farther south, in the area of the Altai and Sayan Mountains[2] (Altai-Sayan region). Their populations are currently small in number, being just under 1,500 and 5,000 respectively. In linguistic anthropology, the Ket language is significant as it is currently the only surviving one in the Yeniseian language family which has been linked by some scholars to the Native American Na-Dené languages[52] and, more controversially, the language of the Huns. (See: L. Lieti, E. Pulleybank,[53] E. Vajda,[54] A. Vovin,[55] etc.)
Q-M346 is also found at lower rates in Sojots (7.1%, Q-M346), Khakassians (6.3%, Q-M346), Kalmyks (3.4%, Q-M25, Q-M346)[49] and Khanty,[56] and so on.


In far eastern Siberia, Q-M242 is found in 35.3% of Nivkhs (Gilyaks) in the lower Amur River, and 33.3% of Chukchi people and 39.2% of Siberian Yupik people in Chukotka (Chukchi Peninsula).[37] It is found in 30.8% of Yukaghirs who live in the basin of the Kolyma River, which is located northwest of Kamchatka.[38] It is also found in 15% (Q1a* 9%, Q-M3 6%) of Koryaks in Kamchatka.[26]



East Asia


In some studies, various subgroups of Q-M242 are observed in Mongolia. Q1a2-M346 (mostly Q-L330) occupies 1.4[26]~3.1%[47] of Mongols (1/2~2/3 among Q samples), followed by Q1a1a1-M120 (0.25[26]~1.25%[47]), Q1a1b-M25 (0.25[26]~0.63%[47]), Q1b-M378. In another study, Q is found in 4% of Mongols.[23] Based on these studies, the average frequency of Q-M242 in Mongols is estimated to be about 4~5%.


However, most of Q-M242 people in East Asia belong to subclade Q-M120, which distributes most intensively across northern China (the provinces of which the capitals locate northern to Huai River-Qin Mountains line). Q-M242 ranged from 4~8% in northwest China (Xinjiang, Gansu, Shaanxi), north China (Shanxi, Hebei), central China (Henan), and upper east China (Shandong) to 3~4% in northeast China. The average frequency of Q-M242 in northern China is around 4.5%. However, it decreases to about 2% in southern China.[40][41] In a study published in 2011, researchers have found Q-M242 in 3.3% (12/361) of the samples of unrelated Han-Chinese male volunteers at Fudan University in Shanghai with the origins from all over China, though with the majority coming from east China.[57]


Q-M242 is found in about 9.5% of Uyghurs,[58] with Q-M346 occupying the half and followed by Q1*, Q-M120, Q-M378, Q-M25. It is also found in approximately 3.2% (5/156 : 2 Q-M120, 3 Q-M346) of males in Tibet.[42]


It is found in about 1.9% of South Koreans,[59][60][61] showing the highest frequency in Seoul and Gyeonggi Province at 2.7% and decreasing ones to the south (Kim 2010). It has been found in about 0.3% of Japanese[62][63][64][65][66] (with known examples from Shizuoka[63] and Saitama[65]) and in 0.3%[45]~1.2%[67] of Taiwanese.


Subclade Q1b-M378 is also found in China and its neighboring countries at very low frequencies. It exists throughout all Mongolia, with rare examples in Japan.[68]



Southeast Asia


Haplogroup Q shows low frequencies in Southeast Asia. In a study,[43] the frequencies of haplogroup Q is 5.4% (2/37) in Indonesia, 3.1% (2/64) in the Philippines, 2.5% (1/40) in Thailand. However, other studies show 0% or near 0% frequencies in those countries.[45]


In the case of Vietnam, the frequency is 7.1% in one study of a sample of Vietnamese reported to be from southern Vietnam[69][70] and 4.3% in a sample of Kinh people from Ho Chi Minh City in southern Vietnam,[66] but 0% or under 1% in other studies in which samples have been collected in Hanoi in northern Vietnam.[43][70][45] So, it is hard to define average frequencies.


Only some regions and ethnic groups in the continent show high frequencies. Q-M242 is found in 2.8% (3/106, all Q-M346) in Myanmar, and all the Q samples are concentrated in 18.8% in Ayeyarwady (2/11) and 7.1% Bago (1/14) regions in southwest Myanmar.[71] And, Q-M242 is found in 55.6% (15/27) in the Akha tribe in northern Thailand.[45]



Central Asia


In Central Asia, the southern regions show higher frequencies of Q than the northern ones.


In the northern regions, Q-M242 is found in about 2%[72]~6%[73][74] (average 4%) of Kazakhs. A study published in 2017 found haplogroup Q Y-DNA in 3.17% (41/1294) of a large pool of samples of Kazakh tribes; however, haplogroup Q was concentrated in the members of the Qangly tribe (27/40 = 67.5%), and it was much less common among the other tribes.[75] The Qangly tribe is related at least in name to the earlier Kankalis and probably also the Kangar union. Haplogroup Q is found in about 2% of Kyrgyz people.[47][73][74]


In the southern regions, Q-M242 is found in 5%[76]~6%[73][74] of Tajiks (Tajikistan). Karafet et al. 2001 found P-DYS257(xQ1b1a1a-M3, R-UTY2), which should be roughly equivalent to haplogroup Q-M242(xM3), in 4/54 = 7.4% of a sample of Uzbeks, apparently sampled in Uzbekistan.[77] Wells et al. 2001 found P-M45(xM120, M124, M3, M173), which should be roughly equivalent to a mix of Q-M242(xM120, M3) and R2-M479(xR2a-M124), in 20/366 = 5.5% of a pool of samples of Uzbeks from seven different regions of Uzbekistan.[73] Di Cristofaro et al. 2013 found Q-M242 in 11/127 = 8.7% of a pool of samples of Uzbeks from three different provinces of Afghanistan, including 5/94 Q-M242(xM120, M25, M346, M378), 4/94 Q-M346, and 1/94 Q-M25 (10/94 = 10.6% Q-M242 total) in a sample of Uzbeks from Jawzjan Province, whose northern border abuts the southeastern corner of Turkmenistan, and 1/28 Q-M242(xM120, M25, M346, M378) in a sample of Uzbeks from Sar-e Pol Province.[47] In case of Turkmenistan, the frequency is not clear, but it can reach about 40% in light of the frequencies (34%~43%) in Turkmens of Afghanistan and Iran who live in the areas adjacent to Turkmenistan.



Southwest Asia


Southwest Asia exhibits high frequencies of Q in northern Iran, and gradually lowering ones to the southwest.


Q-M242 accounts for 5.5% (52/938) in Iran according to Grugni 2012, which shows a large and well allocated sampling. The Q samples (52) in the study consist of various subclades such as Q* (3), Q-M120 (1), Q-M25 (30), Q-M346 (8), Q-M378 (10). The highest frequency is at 42.6% (29/68, all Q-M25) in Turkmens of Golestan, followed by 9.1% in Isfahan (Persian people), 6.8% in Khorasan (Persian people), 6% in Lorestan (Luristan, Lurs), 4.9% in Azarbaijan Gharbi (5.1% of Assyrians and 4.8% of Azeris), 4.5% in Fars (Persian people), and so on.[78] Turkmens are known as the descendants of Oghuz Turks who built many Turkic empires and dynasties. Other studies also show similar frequencies.[79][80][81]


In a study (Zahery 2011), the frequency of Q is 1.9% (3/154: all Q-M378) in Iraqis (x Marsh Arabs), and 2.8% (4/143: 1 Q-M25, 3 Q-M378) in Marsh Arabs who are known as the descendants of ancient Sumerians.[82][83]


Approximately 2.5% (4/157: 3 Q*, 1 Q-M346) of males in Saudi Arabia belong to haplogroup Q. It also accounts for 1.8% (3/164: 2 Q*, 1 Q-M346) in the United Arab Emirates and 0.8% (1/121: Q*) in Oman peoples.[84][85]


Haplogroup Q-M242 has also been found in 1.1% (1/87, Q-P36) Syrians[69] and 2.0% (18/914, 14 Q*, 4 Q-M25) in Lebanese.[86]


Approximately 2% (10/523: 9 Q*, 1 Q-M25) of males in Turkey belong to haplogroup Q.[87] In a study (Gokcumen 2008), it was found that among Turks who belong to the Afshar tribe (one of Oghuz Turks) haplogroup Q-M242 is seen with a prevalence of 13%.[88]



South Asia


Q-M242 accounts for 6.9% of Afghans in a study (Haber 2012). In this study, 18.4% (9/49: 8 Q*, 1 Q-M346) of Pashtuns, the largest ethnic group in Afghanistan, turned out to be haplogroup Q.[89] In another study (Cristofaro 2013) with a large sampling, the frequency of Q rises to 8.9% (45/507). In this study, Turkmens of Jowzjan Province which is neighboring to Turkmenistan show the highest frequency at 33.8% (25/74: 23 Q-M25, 2 Q-M346), followed by Uzbeks at 8.7% (11/144: 6 Q*, 1 Q-M25, 4 Q-M346).[47] If the results of these studies are aggregated and recalculated by population weights of each ethnic group, the frequency of Q in Afghan males will be 6.3%.[90]


In Pakistan at the eastern end of the Iranian Plateau, the frequency of haplogroup Q-M242 is about 2.2% (14/638)[91]~3.4% (6/176).[92]


In a study (Sharma2007), Q-M242 is observed in 2.38% (15/630) of Indian people belonging to different regions and social categories. What is interesting is 14/15 samples do not belong to any known subgroups of Q-M242, with 4 among them showing novel (Indian-specific) ‘ss4bp’ allele under Q-MEH2. This study also reflects the results of some former studies (Sengupta 2006, Seielstad 2003). And, the accumulated result (frequency) of 3 studies is turned out to be 1.3% (21/1615), with 11 out of 21 Q samples.[5] (For more information, see Y-DNA haplogroups in populations of South Asia)


In a regional study in Gujarat (Western India), Q-M242 was found at its highest 12% (3/25) among Nana Chaudharis while the overall percentage in Gujarat was found to be 2.8% (8/284).[93] In another study, 2.6% of Tharus in Chitwan district and 6.1% (3/49) of Hindus in New Delhi, the capital of India were found to be Q-M242 positive.[94]


In a study in which Q-M242 is just classified in P* group, P* (x R1, R2) accounts for 9.7% (23/237: Chakma 13/89, Marma 4/60, Tripura 6/88) in three ethnic groups of Bangladesh.[95] In many cases, all or most of P* (x R1, R2) means Q-M242, and thus most of P* (9.7%) samples in that study can be estimated to be Q-M242.


1.2% of Nepalese people in Kathmandu, the capital of Nepal and 3.2% of people from Tibet are in Q-M242.[42]


3.3% of Sri Lankans[69] are also in Q-M242.



Europe


Q-M242 is distributed across most European countries at low frequencies, and the frequencies decrease to the west and to the south.



Central- and Eastern Europe


In Central- Eastern Europe, Q-M242 comprises about 1.7% of males. Q-M242 is found in about 2% of Russians,[96] 1.5% of Belarusians,[97] 1.3% of Ukrainians[98] 0.5 [99] 1.3% of Poles (Poland),[100] 2% of Czechs,[101] 1.5% of Slovaks,[102] about 2.2% of Hungarians,[103][104] 1.2% of Romanians,[105] 0.8% of Moldovans,[106] and 0.5% (4/808: 2 Q-M378, 1 Q-M346, 1 Q-M25) of Bulgarians[107] On the other hand, 3.1% of Székelys from Transylvania (who have claimed to be descendants of Attila’s Huns) turned out to be P* (xR1-M173),[108] which virtually means Q-M242. In a related DNA Project of FT-DNA, the frequency of Q-M25 in Székelys (Szeklers) reaches 4.3%.[109][110]


The Caucasus region shows a frequency at 1.2% in a study,[80] but it may reach over 4% in Azerbaijan, in that 4.9% of the neighboring Iranian Azerbaijanis harbor Q-M242.[79] It is 1.3% in Georgians and Armenians respectively, and Armenian subclades consist of Q-M378 (L245), Q-M346, and Q-M25.[111]



Northern Europe


In Northern Europe, haplogroup Q comprises about 2.5% of males. According to the Swedish Haplogroup Database, 4.1% (27/664, as of Jan 2016) of Swedish males belong to Q-M242. About 2/3 of the samples analyzed subclades in detail belong to Q1a2b-F1161/L527 and about 1/3 are in Q1a2a-L804. By county, they are distributed intensively in the southern region (Götaland,: not to be confused with Gotland), and rarely to the north. If recalculated by county-population weights, the frequency of Q in Sweden reaches 4.7%.


In Norway, Q-M242 is found in about 2.6% (~4%[112]) of males, with Q-L804 being more common than Q-F1161/L527.[113] It is observed among 1.6% of males in Denmark, 3% in the Faroe Islands (known to be related to Vikings).[114] In an article (Helgason et al.) on the haplotypes of Icelanders, 7.2% (13/181) of males in Iceland are labelled as R1b-Branch A, but they are actually Q-M242.[112][115] On the other hand, it is 0.2% in Finland,[116] 4.6% in Latvia,[117] 1.1% in Lithuania,[118] 0.5% in Estonia.



Western Europe


In Western Europe, Q-M242 is observed at very low frequencies, around 0.5% in most of the countries, such as Germany, France, United Kingdom, etc., but some regions show a little higher. It is 2.1% in Switzerland,[119] and it reaches 5.1% in Lyon (Rhône-Alpes) region of France.[120] It is about 4% in Shetland of northernmost Britain, with a place in it showing the highest figure at 8%. Shetland has been known to be a settlement of Vikings. And, surprisingly, Q-M242 in Shetland (also in some areas of Scandinavia, Faroe Islands, Iceland, and the Great United Kingdom) has turned out to be generically closely linked to the Q-M242 in Central Asia, . Also, Shetland (Norse) Q-M242 is revealed to be linked to some Q-M242 of Azeris (Azerbaijan).[112]



Southern Europe


Southern Europe also shows low frequencies of Q around 0.5%~1%, but some regions exhibits different figures. It is 1.9% in mainland Croatia, but it reaches 14.3% (13/91) in Hvar Islands and 6.1% (8/132) in Korčula.[120] Also, it is about 0.6% in Italy, but it rises to 2.5% (6/236) in Sicily, where it reaches 16.7% (3/18) in Mazara del Vallo region, followed by 7.1% (2/28) in Ragusa, 3.6% in Sciacca,[121] and 3.7% in Belvedere Marittimo.[122]


On the other hand, according to a study (Behar 2004), 5.2% (23/441) of Ashkenazi Jewish males belong to haplogroup Q-P36.[123] This has subsequently been found to be entirely the Q-M378 subclade and may be restricted to Q-L245. Also, 2.3% (4/174)[124]~5.6% (3/53)[125] of Sephardi Jews are in haplogroup Q.



Africa


Haplogroup Q is rarely found across North Africa. It is observed in 0.7% (1/147),[85] of Egyptians and in 0.6% (1/156)[80] of Algerian people. Surprisingly, it is also witnessed in 0.8% (3/381, all Q-M346) of males from Comoros which is located in between East Africa and Madagascar.


To combine the data above, Q-M242 is estimated to be in about 3.1% of males of the world.



Subclade distribution



  • Q (M242)


    • Q* — Found with low frequency in India and Pakistan.[46] Important in Afghanistan, paragroup Q-M242 (xMEH2, xM378) was found in eight Pashtun males (3 Kabul, 4 Laghman, 1 Kapisa).[89] Also found in one Rapanui male of Easter Island.[126]


    • Q-P36.2 (P36.2) Found with low frequency in Iran.[127]


      • Q-MEH2 (MEH2) Was found in Koryaks (at 10.3%), although the level of STR diversity associated with Q-MEH2 is very low, this lineage appears to be closest to the extinct Paleo-Eskimo individuals belonging to the Saqqaq culture arisen in the New World Arctic about 5.5 Ka.[128]


        • Q-M120 (M120, M265/N14) — It has been found at low frequency among Han Chinese,[40][41]Dungans,[73]Vietnamese,[66]Japanese,[65]Kalmyks,[129]Koreans,[73]Mongols in Mongolia,[130]Tibetans,[41][42][67] and Hmong Daw in Laos.[131] It also has been reported in samples of Bhutanese,[132]Hazara,[92] Bruneian Murut,[133] and Peruvian[66] populations.


        • Q-M25 (M25, M143) — Found with high frequency of 30-45% in Turkmens and Turkmenistan Confused with R1b1 because of P25. Found with high frequency in Turkmens of Golestan Province (Iran),[78]Jawzjan ( Afghanistan),[130] and with low to moderate frequency in Lebanon,[134]Mongolia,[130] and Turkey[87]


        • Q-M346 (L56, L57, M346) — Found at low frequency in Europe, South Asia and West Asia. It has been found in Pakistan,[92]Iran,[130]Afghanistan,[130]Kyrgyzstan,[130]Saudi Arabia,[85] the United Arab Emirates,[84]India,[92]Mongolia,[130]Tibet,[42] and Bali.[44]


          • Q-L53 (L53, L54, L55, L213)

            • Q-M3 (M3) — Common in indigenous peoples of the Americas[135]

              • Q-M19 (M19) — Found among some indigenous peoples of South America, such as the Ticuna and the Wayuu[136]

              • Q-M194 (M194) — In South America

              • Q-M199 (M199, P106, P292) — In South America





          • Q-M323 (M323) — It has been detected in Yemenite Jews.[137]






      • Q-L275 (L275, L314)

        • Q-M378 (M378) — It is widely distributed in Europe, South Asia, West and East Asia. It is found among samples of Hazaras and Sindhis.[92] It is also found in the Mongols, the Japanese people and the Uyghurs of North-Western China in two separate groups.[138] The Q-M378 subclade and specifically its Q-L245 subbranch is speculated to be the branch to which Q-M242 men in European Jewish Diaspora populations belong.[123][139] Although published articles have not tested for M378 in Jewish populations, genetic genealogists from the Ashkenazi, Mizrachi, and Sephardi Jewish populations have tested positive for both M378 and L245. Q-M378 samples also has been located in Central America (Panama) and South America (Andean Region)[140]







Y-DNA Q samples from ancient sites




  • South Central Siberia (near Altai)
    • Afontova-Gora-2, Yenisei River Bank, Krasnoyarsk (South Central Siberia of Russia), 17000YBP: Q1a1-F1215 (mtDNA R)[141]


  • North America


    • Anzick-1, Clovis culture, western Montana, 12600YBP: Q1a2-L54* (not M3, mtDNA D4h3a)[142][143]


    • Kennewick Man, Washington, 8500YBP: Q1a2-M3 (mtDNA X2a)[144]




  • Altai (West Mongolia)
    • Tsagaan Asga and Takhilgat Uzuur-5 Kurgan sites, westernmost Mongolian Altai, 2900YBP-4800YBP: 4 R1a1a1b2-Z93 (B.C. 10C, B.C. 14C, 2 period unknown), 3 Q1a2a1-L54 (period unknown), 1 Q-M242 (B.C. 28C), 1 C-M130 (B.C. 10C)[145]


  • Greenland

    • Saqqaq (Qilakitsoq), Greenland, 4000YBP: Q1a-YP1500[146] (mtDNA D2a1)[147]


  • Southern Siberia and Altai

    • In southern Siberia, Karasuk period(1500-800 B.C.) human remains at Sabinka (Khakasiya, Russia) from which three Y-DNA samples were extracted in one case appear to be Q1a:(Allentoft et al. (2015))

    • Sabinka 2 cemetery:
      • sample RISE493, male - 1531-1427 BC - Q1a1b1 (L712)


    • Ancient DNA samples from Hunnic-Sarmatian culture(400-200 B.C.) in Altai Mountains:[110]

      • Sample RISE601, Iron Age archaeological site Verh-Uimon (Altai, Russia) (*L715)

      • Sample RISE600, Iron Age archaeological site Verh-Uimon (Altai, Russia) (*L713)



    • (cf.) Living individuals of Q-L712 Y-DNA are extremely rare. The list of modern individuals:[110]

      • L712* paragroup (Q-L712+ Q-L713-):

      • Szekely (Szekler) subcluster (Q-L712+ Q-L715+ Q-L713+ Q-YP789+) - a common ancestor lived 1700 years ago. This coincides with the arrival of Huns in Europe in 370 AD.

      • Eurasian group (Q-L712+ Q-L715+ Q-L713+ Q-YP789+): Ireland, Poland, Russia, Uzbekistan. Similar to Székely Y-DNA profile, however ethnically not related with the Balkaria/Digora and Székely (Szekler) subcluster.

      • Balkaria/Digora subcluster (Q-L712+ Q-L715+ Q-BZ660+ Q-L713-) - a common ancestor lived 500 years ago. This coincides with the arrival of Badel and Basiat aristocracy in northern Caucasus and the fall of the Golden Horde in 1502.





  • China

    • Hengbei site (Peng kingdom cemetery of Western Zhou period), Jiang County, Shanxi, 2800-3000YBP: 9 Q1a1-M120, 2 O2a-M95, 1 N, 4 O3a2-P201, 2 O3, 4 O*[148]

      • In another paper, the social status of those human remains of ancient Peng kingdom(倗国) are analyzed. aristocrats: 3 Q1a1 (prostrate 2, supine 1), 2 O3a (supine 2), 1 N (prostrate) / commoners : 8 Q1a1 (prostrate 4, supine 4), 3 O3a (prostrate 1, supine 2), 3 O* (supine 3) / slaves: 3 O3a, 2 O2a, 1 O*[149]

      • (cf) Pengbo (倗伯), Monarch of Peng Kingdom is estimated as Q-M120.




    • Pengyang County, Ningxia, 2500YBP: all 4 Q1a1-M120[148] (with a lot of animal bones and bronze swords and other weapons, etc.)

    • Heigouliang, Xinjiang, 2200YBP: 6 Q1a* (not Q1a1-M120, not Q1a1b-M25, not Q1a2-M3), 4 Q1b-M378, 2 Q* (not Q1a, not Q1b: unable to determine subclades):[150]
      • In a paper (Lihongjie 2012), the author analyzed the Y-DNAs of the ancient male samples from the 2nd or 1st century BCE cemetery at Heigouliang in Xinjiang – which is also believed to be the site of a summer palace for Xiongnu kings – which is east of the Barkol basin and near the city of Hami. The Y-DNA of 12 men excavated from the site belonged to Q-MEH2 (Q1a) or Q-M378 (Q1b). The Q-M378 men among them were regarded as hosts of the tombs; half of the Q-MEH2 men appeared to be hosts and the other half as sacrificial victims.



    • Xiongnu site in Barkol, Xinjiang, all 3 Q-M3
      • In L. L. Kang et al. (2013), three samples from a Xiongnu) site in Barkol, Xinjiang were found to be Q-M3 (Q1a2a1a1). And, as Q-M3 is mostly found in Yeniseians and Native Americans, the authors suggest that the Xiongnu had connections to speakers of the Yeniseian languages.[151][152] These discoveries from the above papers (Li 2012, Kang et al., 2013) have some positive implications on the not as yet clearly verified theory that the Xiongnu were precursors of the Huns.


    • Mongolian noble burials in the Yuan dynasty, Shuzhuanglou Site, northernmost Hebei China, 700YBP: all 3 Q (not analysed subclade, the principal occupant Gaodangwang Korguz (高唐王=趙王 阔里吉思)’s mtDNA=D4m2, two others mtDNA=A)[153]
      • (cf) Korguz was a son of a princess of Kublai Khan (元 世祖), and was the king of the Ongud tribe. He died in 1298 and was reburied in Shuzhuanglou in 1311 by his son. (Do not confuse this man with the Uyghur governor, Korguz who died in 1242.) The Ongud tribe (汪古部) was a descendant of the Shatuo tribe (沙陀族) which was a tribe of Göktürks (Western Turkic Khaganate) and was prominent in the Five Dynasties and Ten Kingdoms period of China, building three dynasties. His two queens were all princesses of the Yuan dynasty (Kublai Khan's granddaughters). It was very important for the Yuan dynasty to maintain a marriage alliance with Ongud tribe which had been a principal assistant since Genghis Khan's period. About 16 princesses of the Yuan dynasty got married to kings of the Ongud tribe.






See also



Populations




  • Paleo-Indians

  • Indigenous peoples of the Americas

  • Ket people

  • Selkup people

  • Inuit people

  • Chukchi people

  • Akha people

  • Turkmens

  • Y-DNA haplogroups in populations of South Asia

  • Genetics and archaeogenetics of South Asia

  • Paragroup




Y-DNA Q-M242 subclades




  • Q-M242

  • Q-NWT01

  • Q-M120

  • Q-M25

  • Q-M346

  • Q-L53

  • Q-L54

  • Q-M3

  • Q-M323

  • Q-P89.1

  • Q-Z780

  • Q-L275




Y-DNA backbone tree




















































































































Phylogenetic tree of human Y-chromosome DNA haplogroups [χ 1][χ 2]


"Y-chromosomal Adam"


A00

A0-T [χ 3]


A0

A1 [χ 4]


A1a

A1b


A1b1

BT


B

CT


DE

CF


D

E


C

F


F1
 F2
 F3
 GHIJK


G

HIJK


IJK

H


IJ

K


I  



   LT [χ 5]
      K2 [χ 6]


L  
  T 

  K2a [χ 7]
       K2b [χ 8] 
   K2c
    K2d

K2e [χ 9]  


K-M2313 [χ 10]

    K2b1 [χ 11]

[χ 12]


NO  


[χ 13]

 M [χ 14]   


P1  
  P2


N

O



Q

R



  • Y-DNA by population

  • Y-DNA haplogroups of historic people










References



Citations





  1. ^ Fagundes, Nelson J. R.; Kanitz, Ricardo; Eckert, Roberta; Valls, Ana C. S.; Bogo, Mauricio R.; Salzano, Francisco M.; Smith, David Glenn; Silva, Wilson A.; Zago, Marco A.; Ribeiro-Dos-Santos, Andrea K.; Santos, Sidney E. B.; Petzl-Erler, Maria Luiza; Bonatto, Sandro L. (2008). "Mitochondrial Population Genomics Supports a Single Pre-Clovis Origin with a Coastal Route for the Peopling of the Americas" (pdf). American Journal of Human Genetics. 82 (3): 583–592. doi:10.1016/j.ajhg.2007.11.013. PMC 2427228. PMID 18313026. Retrieved 2009-11-19. Since the first studies, it has been found that extant Native American populations exhibit almost exclusively five "mtDNA haplogroups" (A–D and X)6 classified in the autochthonous haplogroups A2, B2, C1, D1, and X2a.7 Haplogroups A–D are found all over the New World and are frequent in Asia, supporting a northeastern Asian origin of these lineages


  2. ^ abcdefghi Zegura, S. L.; Karafet, TM; Zhivotovsky, LA; Hammer, MF (2004). "High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas" (PDF). Molecular Biology and Evolution. 21 (1): 164–75. doi:10.1093/molbev/msh009. PMID 14595095.


  3. ^ ab YFull YTree v4.02


  4. ^ ab Y-DNA Haplogroup Q and its Subclades - 2016


  5. ^ abc Sharma S, Rai E, Bhat AK, Bhanwer AS, Bamezai RN (2007). "A novel subgroup Q5 of human Y-chromosomal haplogroup Q-M242 in India". BMC Evol. Biol. 7 (1): 232. doi:10.1186/1471-2148-7-232. PMC 2258157. PMID 18021436.


  6. ^ abcd T. M. Karafet, 'High Levels of Y-Chromosome Differentiation among Native Siberian Populations and the Genetic Signature of a Boreal Hunter-Gatherer Way of Life', Human Biology, December 2002, v. 74, no. 6, pp. 761–789


  7. ^ https://www.researchgate.net/publication/310645015_Gene_pool_of_Turkmens_from_Karakalpakstan_in_their_Central_Asian_context_Y-chromosome_polymorphism


  8. ^ abcde Kharkov, V. N.; Stepanov, V. A.; Medvedeva, O. F.; Spiridonova, M. G.; Voevoda, M. I.; Tadinova, V. N.; Puzyrev, V. P. (2007). "Gene Pool Differences between Northern and Southern Altaians Inferred from the Data on Y-Chromosomal Haplogroups". Genetika. 43 (5): 675–687.


  9. ^ ab ZHANG Yong-Ke, CHEN Zheng, FAN An, et al. (2009), "Genetic relationships between Tuva population and the neighboring populations in the Altai Region of Xinjiang Uygur Autonomous Region." HEREDITAS (Beijing) 2009 August, 31(8): 818―824. ISSN 0253-9772. DOI: 10.3724/SP.J.1005.2009.00818


  10. ^ ab Пять генофондов пяти субэтносов сибирских татар


  11. ^ Karafet, Tatiana; Mendez, Fernando; Sudoyo, Herawati (2014). "Improved phylogenetic resolution and rapid diversification of Y-chromosome haplogroup K-M526 in Southeast Asia". Nature. 23 (3): 369–373. doi:10.1038/ejhg.2014.106. PMC 4326703. PMID 24896152.


  12. ^ Proposed Tree Archived 2011-07-11 at the Wayback Machine.


  13. ^ Krahn, Thomas. "FTDNA Draft Y-DNA Tree (AKA YTree)". Family Tree DNA. Archived from the original on 2015-08-15. Retrieved 2012. Check date values in: |accessdate= (help)


  14. ^ Karafet, T. M.; Mendez, F. L.; Meilerman, M. B.; Underhill, P. A.; Zegura, S. L.; Hammer, M. F. (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–8. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274.


  15. ^ "Y-DNA Haplotree".
    Family Tree DNA uses the Y-Chromosome Consortium tree and posts it on their website.



  16. ^ That is because it is a value for the STR DYS435 with a value of 8--> 9 within haplogroup Q-M242 and the trend is to include only binary markers in phylogenetic trees. However, these are from studies where all current branches of the Q-M242 tree have not been tested. The problematic phylogeny sampling of early studies has been demonstrated by subsequent studies that have found Q-M346, Q-M378, and Q-M25 in South Asia.


  17. ^ Malhi, RS; Gonzalez-Oliver, A; Schroeder, KB; Kemp, BM; Greenberg, JA; Dobrowski, SZ; Smith, DG; Resendez, A; Karafet, T; Hammer, M; Zegura, S; Brovko, T (2008). "Distribution of Y chromosomes among native North Americans: a study of Athapaskan population history". Am. J. Phys. Anthropol. 137 (4): 412–24. doi:10.1002/ajpa.20883. PMC 2584155. PMID 18618732.


  18. ^ "Frequency Distribution of Y-DNA Haplogroup Q M3". GeneTree. 2010. Archived from the original on 2009-11-04. Retrieved 2010-01-30.


  19. ^ Rasmussen, M; Li, Y; Lindgreen, S; Pedersen, JS; Albrechtsen, A; Moltke, I; Metspalu, M; Metspalu, E; Kivisild, T; Gupta, R; Bertalan, M; Nielsen, K; Gilbert, MT; Wang, Y; Raghavan, M; Campos, PF; Kamp, HM; Wilson, AS; Gledhill, A; Tridico, S; Bunce, M; Lorenzen, ED; Binladen, J; Guo, X; Zhao, J; Zhang, X; Zhang, H; Li, Z; Chen, M; Orlando, L; Kristiansen, K; Bak, M; Tommerup, N; Bendixen, C; Pierre, TL; Grønnow, B; Meldgaard, M; Andreasen, C; Fedorova, SA; Osipova, LP; Higham, TF; Ramsey, CB; Hansen, TV; Nielsen, FC; Crawford, MH; Brunak, S; Sicheritz-Pontén, T; Villems, R; Nielsen, R; Krogh, A; Wang, J; Willerslev, E (2010). "Ancient human genome sequence of an extinct Palaeo-Eskimo". Nature. 463 (7282): 463, 757–762. doi:10.1038/nature08835. PMC 3951495. PMID 20148029. Retrieved 2010-02-11.


  20. ^ Katharina Olofsson, Jill; et al. (2015). "Peopling of the North Circumpolar Region – Insights from Y Chromosome STR and SNP Typing of Greenlanders". PLOS ONE. 10 (1): e0116573. doi:10.1371/journal.pone.0116573. PMC 4312058. PMID 25635810.CS1 maint: Explicit use of et al. (link)


  21. ^ Population Estimates Archived 2014-12-18 at the Wayback Machine.


  22. ^ Hammer; et al. (Dec 2006). "Population structure of Y chromosome SNP haplogroups in the United States and forensic implications for constructing Y chromosome STR databases". Forensic Sci. Int. 164 (1): 45–55. doi:10.1016/j.forsciint.2005.11.013. PMID 16337103.CS1 maint: Explicit use of et al. (link)


  23. ^ ab Bortolini, M; Salzano, F; Thomas, M; Stuart, S; Nasanen, S; Bau, C; Hutz, M; Layrisse, Z; et al. (2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas". The American Journal of Human Genetics. 73 (3): 524–39. doi:10.1086/377588. PMC 1180678. PMID 12900798.


  24. ^ Vullo, Carlos; et al. (2014). "Association between Y haplogroups and autosomal AIMs reveals intra-population substructure in Bolivian populations". Int J Legal Med. 129 (4): 673–680. doi:10.1007/s00414-014-1025-x. PMID 24878616.


  25. ^ Söchtig, Jens; et al. (2015). "Genomic insights on the ethno-history of the Maya and the 'Ladinos' from Guatemala". BMC Genomics. 16: 131. doi:10.1186/s12864-015-1339-1. PMC 4422311. PMID 25887241.CS1 maint: Explicit use of et al. (link) => Guatemala population consists of about 40% Natives (Mayans)+60% Ladinos. According to this paper, 89% of Mayan and 25% of Ladinos belong to Y-DNA Q. Thus, 40*0.89+60*0.25=50.6%


  26. ^ abcdefgh Battaglia; et al. (2013). "The First Peopling of South America: New Evidence from Y-Chromosome Haplogroup Q". PLOS ONE. 8 (8): e71390. doi:10.1371/journal.pone.0071390. PMC 3749222. PMID 23990949.


  27. ^ Gaviria, A.; et al. (2013). "Characterization and Haplotype analysis of 11 Y-STR loci in Ecuadorian population". Forensic Sci. Int. Genet. Suppl. doi:10.1016/j.fsigss.2013.10.15 (inactive 2018-11-02).


  28. ^ Martínez-Cortés, G; et al. (2012). "Admixture and population structure in Mexican-Mestizos based on paternal lineages". J. Hum. Genet. 57 (9): 568–74. doi:10.1038/jhg.2012.67. PMID 22832385.


  29. ^ Lovo-Gómez, J; et al. (Sep 2007). "The genetic male legacy from El Salvador". Forensic Sci. Int. 171 (2–3): 198–203. doi:10.1016/j.forsciint.2006.07.005. PMID 16916590.CS1 maint: Explicit use of et al. (link)


  30. ^ Grugni (2015). "Exploring the Y Chromosomal Ancestry of Modern Panamanians". PLOS ONE. 10 (12): e0144223. doi:10.1371/journal.pone.0144223. PMC 4670172. PMID 26636572.


  31. ^ Rojas, Win; et al. (2010). "Genetic Make Up and Structure of Colombian Populations by Means of Uniparental and Biparental DNA Markers". American Journal of Physical Anthropology. 143 (1): 13–20. doi:10.1002/ajpa.21270. PMID 20734436.CS1 maint: Explicit use of et al. (link) => (DANE, 2006) 86% of the whole Colombian population self-reported as of Mixed Ancestary, 3.4% as Native American, 10.5% as African-Columbian. In this paper, 12% (114/954) of MA, 95.7% (135/141) of NA, and 23.8% (5/21) of AC are turned out to be Y-DNA Q. Thus, 86*0.12+3.4*0.957+10.5*0.238=16.1%


  32. ^ Núñez, Carolina; et al. (2012). "Y chromosome haplogroup diversity in a Mestizo population of Nicaragua". Forensic Sci. Int. Genet. 6 (6): e192–e195. doi:10.1016/j.fsigen.2012.06.011. PMID 22770600.CS1 maint: Explicit use of et al. (link) The author revised his previous paper, genotyping 2 more samples as haplogroup Q by Y-SNP test.


  33. ^ Corach, Daniel; et al. (2010). "Inferring Continental Ancestry of Argentineans from Autosomal, Y-Chromosomal and Mitochondrial DNA". Annals of Human Genetics. 74 (1): 65–76. doi:10.1111/j.1469-1809.2009.00556.x. PMID 20059473.CS1 maint: Explicit use of et al. (link)


  34. ^ Ramallo; et al. (Dec 2009). "Comparison of Y-chromosome haplogroup frequencies in eight Provinces of Argentina". Forensic Science International Genetics Supplement Series. 2 (1): 431–432. doi:10.1016/j.fsigss.2009.08.047.CS1 maint: Explicit use of et al. (link)


  35. ^ http://www.fsigeneticssup.com/article/S1875-1768 (08)00138-8/fulltext(To read this document, allow cookies on your internet option), 5 out of 100 samples in the Y-STR table can be classified as haplogroup Q-M3.


  36. ^ Palha, T.; et al. (2012). "Disclosing the Genetic Structure of Brazil through Analysis of Male Lineages with Highly Discriminating Haplotypes". PLOS ONE. 7 (7): e40007. doi:10.1371/journal.pone.0040007. PMC 3393733. PMID 22808085.CS1 maint: Explicit use of et al. (link) => about 80 out of 2,024 (3.95%) samples in the paper collected from all the regions of Brazil can be classified as Y-DNA Q.


  37. ^ ab Jeffrey, T.; et al. (Jan 2002). "The Dual Origin and Siberian Affinities of Native American Y Chromosomes". Am J Hum Genet. 70 (1): 192–206. doi:10.1086/338457. PMC 384887. PMID 11731934.CS1 maint: Explicit use of et al. (link) The SNPs used in the paper are P-M45, R1a1-M17, Q1a2-M3, and other xP-M45 SNPs. And the author mentions that, among ethnic groups in the paper, R1-M173 is harbored only in some eastern Siberian Udegeys and Koryaks and Native Americans. Also, R2 (distributed in India and its neighbours) cannot be found in far east Siberia. Thus, P-M45 except some samples mentioned above virtually means Q-M242 (xM3). In the paper, 35.3% of Nivkhs and 20.8% of Chukchi people and 18.2% of Siberian Eskimos are shown in P-M45, and 12.5% of Chukchis and 21.2% of Siberian Eskimos are in Q-M3. All of them can be estimated to be in haplogroup Q.


  38. ^ ab Pakendorf, Brigitte; Novgorodov, Innokentij N.; Osakovskij, Vladimir L.; Danilova, Al’Bina P.; Protod’Jakonov, Artur P.; Stoneking, Mark (2006). "Investigating the effects of prehistoric migrations in Siberia: genetic variation and the origins of Yakuts". Human Genetics. 120 (3): 334–353. doi:10.1007/s00439-006-0213-2. PMID 16845541.


  39. ^ ab Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; Omoto, Keiichi; Harihara, Shinji; Stoneking, Mark; Horai, Satoshi (2005). "Dual origins of the Japanese: Common ground for hunter-gatherer and farmer Y chromosomes". Journal of Human Genetics. 51 (1): 47–58. doi:10.1007/s10038-005-0322-0. PMID 16328082.


  40. ^ abc Wen B, Li H, Lu D, et al. (September 2004). "Genetic evidence supports demic diffusion of Han culture". Nature. 431 (7006): 302–5. doi:10.1038/nature02878. PMID 15372031. Supplementary Table 2: NRY haplogroup distribution in Han populations


  41. ^ abcd Su, Bing; Xiao, Chunjie; Deka, Ranjan; Seielstad, Mark T.; Kangwanpong, Daoroong; Xiao, Junhua; Lu, Daru; Underhill, Peter; et al. (2000). "Y chromosome haplotypes reveal prehistorical migrations to the Himalayas". Human Genetics. 107 (6): 582–90. doi:10.1007/s004390000406. PMID 11153912.


  42. ^ abcde Gayden, Tenzin; et al. (May 2007). "The Himalayas as a Directional Barrier to Gene Flow". Am J Hum Genet. 80 (5): 884–894. doi:10.1086/516757. PMC 1852741. PMID 17436243.CS1 maint: Explicit use of et al. (link)


  43. ^ abc Kim, Soon-Hee; et al. (2011). "High frequencies of Y-chromosome haplogroup O2b-SRY465 lineages in Korea: a genetic perspective on the peopling of Korea". Investigative Genetics. 2 (1): 10. doi:10.1186/2041-2223-2-10. PMC 3087676. PMID 21463511.CS1 maint: Explicit use of et al. (link)


  44. ^ ab Karafet, Tatiana M.; Hallmark, Brian; Cox, Murray P.; et al. (2010). "Major East–West Division Underlies Y Chromosome Stratification across Indonesia". Mol. Biol. Evol. 27 (8): 1833–1844. doi:10.1093/molbev/msq063. PMID 20207712.


  45. ^ abcde Trejaut, J.A. (2014). "Taiwan Y-chromosomal DNA variation and its relationship with Island Southeast Asia". BMC Genetics. 15: 77. doi:10.1186/1471-2156-15-77. PMC 4083334. PMID 24965575.


  46. ^ abc The Y Chromosome Consortium 2008


  47. ^ abcdefg Cristofaro; et al. (2013). "Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge". PLOS ONE. 8 (10): e76748. doi:10.1371/journal.pone.0076748. PMC 3799995. PMID 24204668.CS1 maint: Explicit use of et al. (link)


  48. ^ Dulik, M C (Feb 2012). "Mitochondrial DNA and Y Chromosome Variation Provides Evidence for a Recent Common Ancestry between Native Americans and Indigenous Altaian". Am J Hum Genet. 90 (2): 229–246. doi:10.1016/j.ajhg.2011.12.014. PMC 3276666. PMID 22281367.


  49. ^ abcd Malyarchuk, Boris; et al. (2011). "Ancient links between Siberians and Native Americans revealed by subtyping the Y chromosome haplogroup Q1a". Journal of Human Genetics. 56 (8): 583–588. doi:10.1038/jhg.2011.64. PMID 21677663.CS1 maint: Explicit use of et al. (link)


  50. ^ Cite error: The named reference Kharkov2012 was invoked but never defined (see the help page).



  51. ^ Cite error: The named reference Derenko2006 was invoked but never defined (see the help page).



  52. ^ E. J. VAJDA, "Siberian Link with Na-Dene Languages." The Dene–Yeniseian Connection, ed. by J. Kari and B. Potter(2010), pp.33–99, Anthropological Papers of the University of Alaska, new series, vol. 5(2010), Fairbanks: University of Alaska Fairbanks, Department of Anthropology


  53. ^ E. G. Pulleyblank, "The consonontal system of old Chinese" [Pt 1], Asia Major, vol. IX (1962), pp. 1–2


  54. ^ E. J. Vajda, Yeniseian Peoples and Languages: A History of Yeniseian Studies with an Annotated Bibliography and a Source Guide (2013, Oxford/New York, Routledge) pp.103-106, etc.


  55. ^ "Did the Xiong-nu speak a Yeniseian language?". Central Asiatic Journal. 44 (1): 87–104. 2000.


  56. ^ Mirabal S, Regueiro M, Cadenas AM, et al. (March 2009). "Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia". Eur. J. Hum. Genet. 17 (10): 1260–73. doi:10.1038/ejhg.2009.6. PMC 2986641. PMID 19259129.


  57. ^ Yan, Shi; Chuan-; Wang, Chao; Li, Hui; et al. (2011). "An updated tree of Y-chromosome Haplogroup O and revised phylogenetic positions of mutations P164 and PK4". European Journal of Human Genetics. 19 (9): 1013–1015. doi:10.1038/ejhg.2011.64. PMC 3179364. PMID 21505448.


  58. ^ Shan; et al. (Sep 2014). "Genetic polymorphism of 17 Y chromosomal STRs in Kazakh and Uighur populations from Xinjiang, China". Int J Legal Med. 128 (5): 743–4. doi:10.1007/s00414-013-0948-y. PMID 24398978.CS1 maint: Explicit use of et al. (link)


  59. ^ Kim, Soon-Hee; et al. (Nov 2010). "'Y chromosome homogeneity in the Korean population". Int J Legal Med. 124 (6): 653–7. doi:10.1007/s00414-010-0501-1. PMID 20714743.CS1 maint: Explicit use of et al. (link)


  60. ^ Jin Park, Myung; et al. (2012). "Understanding the Y chromosome variation in Korea-relevance of combined haplogroup and haplotype analyses". International Journal of Legal Medicine. 126 (4): 589–599. doi:10.1007/s00414-012-0703-9. PMID 22569803.CS1 maint: Explicit use of et al. (link)


  61. ^ The frequencies of Q-M242 shown in both studies (Kim2010, Park2012) are 1.4% (7/506, Kim) and 1.8% (13/706, Park) respectively. But, if recalculated by regional population weights, the adjusted frequencies reach 1.87% (Kim) and 1.91% (Park) respectively, converging to 1.9%.


  62. ^ Peter A. Underhill, Peidong Shen, Alice A. Lin, et al. (2000), "Y chromosome sequence variation and the history of human populations." Nature Genetics, Volume 26, November 2000.


  63. ^ ab Michael F. Hammer, Tatiana M. Karafet, Hwayong Park, et al. (2006), "Dual origins of the Japanese: common ground for hunter-gatherer and farmer Y chromosomes." Journal of Human Genetics (2006) 51:47–58. DOI 10.1007/s10038-005-0322-0.


  64. ^ Yali Xue, Tatiana Zerjal, Weidong Bao, et al. (2006), "Male Demography in East Asia: A North–South Contrast in Human Population Expansion Times." Genetics 172: 2431–2439 (April 2006).


  65. ^ abc Nonaka, I.; Minaguchi, K.; Takezaki, N. (2007). "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms" (PDF). Annals of Human Genetics. 71 (4): 480–495. doi:10.1111/j.1469-1809.2006.00343.x. PMID 17274803.


  66. ^ abcd G. David Poznik, Yali Xue, Fernando L. Mendez, et al. (2016), "Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences." Nature Genetics 2016 June ; 48(6): 593–599. doi:10.1038/ng.3559.


  67. ^ ab Wang C-C, Wang L-X; Shrestha, R; Zhang, M; Huang, X-Y; et al. (2014). "Genetic Structure of Qiangic Populations Residing in the Western Sichuan Corridor". PLoS ONE. 9 (8): e103772. doi:10.1371/journal.pone.0103772. PMC 4121179. PMID 25090432.


  68. ^ Y-chromosome lineage in five regional Mongolian populations Toshimichi Yamamotoemail, Tomoki Senda, Daiki Horiba, Masayoshi Sakuma, Yuuka Kawaguchi, Yuuichi Kano


  69. ^ abc Karafet, TM; et al. (Feb 2005). "Balinese Y-chromosome perspective on the peopling of Indonesia: genetic contributions from pre-neolithic hunter-gatherers, Austronesian farmers, and Indian traders". Hum. Biol. 77 (1): 93–114. doi:10.1353/hub.2005.0030. hdl:1808/13586. PMID 16114819.CS1 maint: Explicit use of et al. (link)


  70. ^ ab He J-D, Peng M-S, Quang HH, Dang KP, Trieu AV, et al. (2012), "Patrilineal Perspective on the Austronesian Diffusion in Mainland Southeast Asia." PLoS ONE 7(5): e36437. doi:10.1371/journal.pone.0036437


  71. ^ Peng, Min-Sheng; et al. (Aug 2014). "Retrieving Y chromosomal haplogroup trees using GWAS data". Eur J Hum Genet. 22 (8): 1046–1050. doi:10.1038/ejhg.2013.272. PMC 4350590. PMID 24281365.CS1 maint: Explicit use of et al. (link)


  72. ^ Turspekov; et al. (2012). "The Kazakhstan DNA project hits first hundred Y-profiles for ethnic Kazakhs". The Russian Journal of Genetic Genealogy. 2: 1.CS1 maint: Explicit use of et al. (link)


  73. ^ abcdef Wells RS, Yuldasheva N, Ruzibakiev R, et al. (August 2001). "The Eurasian Heartland: A continental perspective on Y-chromosome diversity". Proc. Natl. Acad. Sci. U.S.A. 98 (18): 10244–9. doi:10.1073/pnas.171305098. PMC 56946. PMID 11526236. Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region


  74. ^ abc Seielstad, Mark; et al. (Sep 2003). "A Novel Y-Chromosome Variant Puts an Upper Limit on the Timing of First Entry into the Americas". Am J Hum Genet. 73 (3): 700–705. doi:10.1086/377589. PMC 1180698. PMID 12929085.CS1 maint: Explicit use of et al. (link)


  75. ^ E. E. Ashirbekov, D. M. Botbaev, A. M. Belkozhaev, A. O. Abayldaev, A. S. Neupokoeva, J. E. Mukhataev, B. Alzhanuly, D. A. Sharafutdinova, D. D. Mukushkina, M. B. Rakhymgozhin, A. K. Khanseitova, S. A. Limborska, and N. A. Aytkhozhina, "Distribution of Y-Chromosome Haplogroups of the Kazakh from the South Kazakhstan, Zhambyl, and Almaty Regions." Reports of the National Academy of Sciences of the Republic of Kazakhstan, ISSN 2224-5227, Volume 6, Number 316 (2017), 85 - 95.


  76. ^ Malyarchuk, B; et al. (Jan 2013). "Y-chromosome variation in Tajiks and Iranians". Ann. Hum. Biol. 40 (1): 48–54. doi:10.3109/03014460.2012.747628. PMID 23198991.CS1 maint: Explicit use of et al. (link)


  77. ^ Karafet; et al. (Sep 2001). "Paternal Population History of East Asia: Sources, Patterns, and Microevolutionary Processes". Am J Hum Genet. 69 (3): 615–628. doi:10.1086/323299. PMC 1235490. PMID 11481588.CS1 maint: Explicit use of et al. (link)


  78. ^ ab Grugni, Viola; et al. (2012). "Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians". PLOS ONE. 7 (7): e41252. doi:10.1371/journal.pone.0041252. PMC 3399854. PMID 22815981.CS1 maint: Explicit use of et al. (link)


  79. ^ ab Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ (2006). "Iran: tricontinental nexus for Y-chromosome driven migration". Hum. Hered. 61 (3): 132–43. doi:10.1159/000093774. PMID 16770078.


  80. ^ abc Bekada, Asmahan; et al. (2013). "Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape". PLOS ONE. 8 (2): e56775. doi:10.1371/journal.pone.0056775. PMC 3576335. PMID 23431392.CS1 maint: Explicit use of et al. (link)


  81. ^ The frequency of Q is 4% (6/150, all Q-M25) in Regueiro 2006, in which it is 9.1% (3/33) in north Iran and 2.6% (3/117) in south Iran. But, since more people live in the northern regions, if recalculated by population weights, the frequency will reach about 6%. It is also 6.2% (35/566) in Bekada 2013 with a large-scale sampling.


  82. ^ Al-Zahery, Nadia; et al. (2011). "In search of the genetic footprints of Sumerians: a survey of Y-chromosome and mtDNA variation in the Marsh Arabs of Iraq". BMC Evolutionary Biology. 11: 288. doi:10.1186/1471-2148-11-288. PMC 3215667. PMID 21970613.CS1 maint: Explicit use of et al. (link)


  83. ^ According to scholars, early Sumerians called themselves 'black-headed people', and spoke an agglutinative language with the word order of SOV, which was quite different from common Semitic or Indo-European languages. Among Semitic languages, only Akkadian had SOV word order, which is due to the influence of the Sumerian language.(For more information, see Sumer, Sumerian Language, Akkadian language, and so on.) On the other hand, surprisingly, some ancient writings found in Bolivia such as Pokotia Monolith, have been interpreted with the Proto-Sumerian language. http://www.faculty.ucr.edu/~legneref/biados/texts/WintersPokotia.htm


  84. ^ ab Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ (March 2008). "Y-chromosome diversity characterizes the Gulf of Oman". Eur. J. Hum. Genet. 16 (3): 374–86. doi:10.1038/sj.ejhg.5201934. PMID 17928816.


  85. ^ abc Abu-Amero, Khaled K.; Hellani, Ali; Gonzalez, Ana M.; Larruga, Jose M; Cabrera, Vicente M; Underhill, Peter A (2009). "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions". BMC Genetics. 10 (1): 59. doi:10.1186/1471-2156-10-59. PMC 2759955. PMID 19772609.


  86. ^ Zalloua PA, Xue Y, Khalife J, et al. (April 2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". Am. J. Hum. Genet. 82 (4): 873–82. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297.


  87. ^ ab Cinnioğlu C, King R, Kivisild T, et al. (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Hum. Genet. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639.


  88. ^ Gokcumen, Omer (2008). Ethnohistorical and Genetic Survey of Four Central Anatolian Settlements. University of Pennsylvania. ISBN 978-0-549-80966-1. Retrieved May 13, 2014.


  89. ^ ab Haber M, Platt DE, Ashrafian Bonab M, Youhanna SC, Soria-Hernanz DF, et al. (2012). "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events". PLoS ONE. 7 (3): e34288. doi:10.1371/journal.pone.0034288. PMC 3314501. PMID 22470552.


  90. ^ To aggregate the results of Haber 2012 and Cristofaro 2013, the frequency of each ethnic group is 33.3% (25/75) in Turkmens, followed by 8.1% (11/136) in Pashtuns, 7.6% in Uzbeks (11/144), 4.4% in Hazara, 3.0% in Tajiks. Currently, Afghans consist of Pashtun 42%, Tajik 27%, Hazara 9%, Uzbek 9%, Turkmen 3%, others 10%. Thus, if recalculated by population weights of ethnic groups, the frequency of Q in Afghans will be 6.3%.


  91. ^ Firasat, Sadaf; Khaliq, Shagufta; Mohyuddin, Aisha; Papaioannou, Myrto; Tyler-Smith, Chris; Underhill, Peter A; Ayub, Qasim (2007). "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan". European Journal of Human Genetics. 15 (1): 121–126. doi:10.1038/sj.ejhg.5201726. PMC 2588664. PMID 17047675.


  92. ^ abcde Sengupta, Sanghamitra; Zhivotovsky, Lev A.; King, Roy; Mehdi, S.Q.; Edmonds, Christopher A.; Cheryl-, Cheryl-Emiliane T.; Chow, Emiliane T.; Lin, Alice A.; et al. (2006). "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists". The American Journal of Human Genetics. 78 (2): 202–221. doi:10.1086/499411. PMC 1380230. PMID 16400607.


  93. ^ Khurana, P; et al. (2014). "Y Chromosome Haplogroup Distribution in Indo-European Speaking Tribes of Gujarat, Western India". PLOS ONE. 9 (3): e90414. doi:10.1371/journal.pone.0090414. PMC 3948632. PMID 24614885.CS1 maint: Explicit use of et al. (link)


  94. ^ Fornarino, Simona; et al. (2009). "Mitochondrial and Y-chromosome diversity of the Tharus (Nepal): a reservoir of genetic variation". BMC Evol. Biol. 9: 154. doi:10.1186/1471-2148-9-154. PMC 2720951. PMID 19573232.CS1 maint: Explicit use of et al. (link)


  95. ^ Nahar Gazi, Nurun; et al. (2013). "Genetic Structure of Tibeto-Burman Populations of Bangladesh: Evaluating the Gene Flow along the Sides of Bay-of-Bengal". PLOS ONE. 8 (10): e75064. doi:10.1371/journal.pone.0075064. PMC 3794028. PMID 24130682.CS1 maint: Explicit use of et al. (link)


  96. ^ Malyarchuk, B. A.; et al. (2008). "Gene Pool Structure of Russian Populations from the European Part of Russia Inferred from the Data on Y Chromosome Haplogroups Distribution". Russian Journal of Genetics. 44 (2): 187–192. doi:10.1134/S1022795408020105.CS1 maint: Explicit use of et al. (link)


  97. ^ Khar'kov, VN; et al. (Aug 2005). "Frequencies of Y chromosome binary haplogroups in Belarussians". Genetika. 41 (8): 1132–6. PMID 16161635.CS1 maint: Explicit use of et al. (link)


  98. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".


  99. ^ "Eupedia".


  100. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".


  101. ^ Ehler, Edvard; et al. (Jun 2011). "Y-chromosomal diversity of the Valachs from the Czech Republic: model for isolated population in Central Europe". Croat Med J. 52 (3): 358–367. doi:10.3325/cmj.2011.52.358. PMC 3131682. PMID 21674832.CS1 maint: Explicit use of et al. (link)


  102. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".


  103. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".


  104. ^ Kristiina, Tambets. The Western; Eastern; et al. (Apr 2004). "Outliers" Told by Mitochondrial DNA and Y Chromosomes". Am J Hum Genet. 74 (4): 661–682. doi:10.1086/383203. PMC 1181943. PMID 15024688.CS1 maint: Explicit use of et al. (link)


  105. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".


  106. ^ Varzari, Alexander; et al. (2013). "Paleo-Balkan and Slavic Contributions to the Genetic Pool of Moldavians: Insights from the Y Chromosome". PLOS ONE. 8 (1): e53731. doi:10.1371/journal.pone.0053731. PMC 3547065. PMID 23341985.CS1 maint: Explicit use of et al. (link)


  107. ^ Karachanak, Sena; et al. (2013). "Y-Chromosome Diversity in Modern Bulgarians: New Clues about Their Ancestry". PLOS ONE. 8 (3): e56779. doi:10.1371/journal.pone.0056779. PMC 3590186. PMID 23483890.CS1 maint: Explicit use of et al. (link)


  108. ^ Csányi, B.; et al. (July 2008). "Y-Chromosome Analysis of Ancient Hungarian and Two Modern Hungarian-Speaking Populations from the Carpathian Basin". Annals of Human Genetics. 72 (4): 519–534. doi:10.1111/j.1469-1809.2008.00440.x. PMID 18373723.CS1 maint: Explicit use of et al. (link)


  109. ^ Hungarian Bukovina


  110. ^ abc Q-L712 Subclades of haplogroup Q-M25: Q-L712, Q-L715, Q-L713, Q-YP789


  111. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".


  112. ^ abc David K. Faux, 2007, The Genetic Link of the Viking – Era Norse to Central Asia: An Assessment of the Y Chromosome DNA, Archaeological, Historical and Linguistic Evidence, http://www.davidkfaux.org/CentralAsiaRootsofScandinavia-Y-DNAEvidence.pdf


  113. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".


  114. ^ Allison Mann, Vikings, merchants, and pirates at the top of the world : Y-chromosomal signatures of recent and ancient migrations in the Faroe Islands, MA Thesis of University of Louisville, 2012.


  115. ^ Shetland Islands Haplogroups R1a & Q


  116. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".


  117. ^ "Family Tree DNA - My FamilyTree DNA Latvia Project Website".


  118. ^ "Family Tree DNA - LITHUANIAN DNA".


  119. ^ "Family Tree DNA - Switzerland DNA Project".


  120. ^ ab Wiik, Kalevi (2008). "Where did European Men Come From?". Journal of Genetic Genealogy. 4: 35–85.


  121. ^ Di Gaetano, Cornelia; et al. (Jan 2009). "Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome". Eur J Hum Genet. 17 (1): 91–99. doi:10.1038/ejhg.2008.120. PMC 2985948. PMID 18685561.CS1 maint: Explicit use of et al. (link)


  122. ^ Brisighelli, F (2012). "Uniparental markers of contemporary Italian population reveals details on its pre-Roman heritage". PLOS ONE. 7 (12): e50794. doi:10.1371/journal.pone.0050794. PMC 3519480. PMID 23251386. In Table S4, #BEL50 is estimated to be Q-M378 by haplotype, though it is shown as just P* (xR1).


  123. ^ ab Behar, DM; et al. (Mar 2004). "Contrasting patterns of Y chromosome variation in Ashkenazi Jewish and host non-Jewish European populations". Hum Genet. 114 (4): 354–65. doi:10.1007/s00439-003-1073-7. PMID 14740294.CS1 maint: Explicit use of et al. (link)


  124. ^ Adams, Susan M.; et al. (Dec 2008). "The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula". Am J Hum Genet. 83 (6): 725–736. doi:10.1016/j.ajhg.2008.11.007. PMC 2668061. PMID 19061982.CS1 maint: Explicit use of et al. (link)


  125. ^ Alain Farhi et al., Preliminary Results of Sephardic DNA Testing, AVOTAYNU Volume XXIII, Number 2 Summer 2007, p.10


  126. ^ Y-chromosome-Specific STR haplotype data on the Rapanui population (Easter Island).
    PMID 17506287 DOI: 10.1353/hub.2007.0005



  127. ^ Grugni, Viola; Battaglia, Vincenza; Hooshiar Kashani, Baharak; Parolo, Silvia; Al-Zahery, Nadia; Achilli, Alessandro; Olivieri, Anna; Gandini, Francesca; Houshmand, Massoud; Sanati, Mohammad Hossein; Torroni, Antonio; Semino, Ornella (2012). "Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians". PLoS ONE. 7 (7): e41252. doi:10.1371/journal.pone.0041252. PMC 3399854. PMID 22815981.


  128. ^ Malyarchuk, Boris; Derenko, Miroslava; Denisova, Galina; Maksimov, Arkady; Wozniak, Marcin; Grzybowski, Tomasz; Dambueva, Irina; Zakharov, Ilya (2011). "Ancient links between Siberians and Native Americans revealed by subtyping the Y chromosome haplogroup Q1a". Journal of Human Genetics. 56 (8): 583–8. doi:10.1038/jhg.2011.64. PMID 21677663.


  129. ^ Boris Malyarchuk, Miroslava Derenko, Galina Denisova, Sanj Khoyt, Marcin Woźniak, Tomasz Grzybowski, and Ilya Zakharov, "Y-chromosome diversity in the Kalmyks at the ethnical and tribal levels." Journal of Human Genetics (2013) 58, 804–811; doi:10.1038/jhg.2013.108.


  130. ^ abcdefg Di Cristofaro, J; Pennarun, E; Mazières, S; Myres, NM; Lin, AA; et al. (2013). "Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge". PLoS ONE. 8 (10): e76748. doi:10.1371/journal.pone.0076748. PMC 3799995. PMID 24204668.


  131. ^ Cai, X; Qin, Z; Wen, B; Xu, S; Wang, Y; Lu, Yan; Wei, Lanhai; Wang, Chuanchao; Li, Shilin; Huang, Xingqiu; Jin, Li; Li, Hui (2011). "Human Migration through Bottlenecks from Southeast Asia into East Asia during Last Glacial Maximum Revealed by Y Chromosomes". PLoS ONE. 6 (8): e24282. doi:10.1371/journal.pone.0024282. PMC 3164178. PMID 21904623.


  132. ^ Pille Hallast, Chiara Batini, Daniel Zadik, et al., "The Y-Chromosome Tree Bursts into Leaf: 13,000 High-Confidence SNPs Covering the Majority of Known Clades." Molecular Biology and Evolution Advance Access publication December 2, 2014. doi:10.1093/molbev/msu327


  133. ^ Monika Karmin, Lauri Saag, Mário Vicente, et al. (2015), "A recent bottleneck of Y chromosome diversity coincides with a global change in culture." Genome Research 25:1–8. Published by Cold Spring Harbor Laboratory Press; ISSN 1088-9051/15; www.genome.org.


  134. ^ Zalloua, Pierre A.; Xue, Y; Khalife, J; Makhoul, N; Debiane, L; Platt, DE; Royyuru, AK; Herrera, RJ; et al. (2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". American Journal of Human Genetics. 82 (4): 873–882. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297.


  135. ^ "Learn about Y-DNA Haplogroup Q". Wendy Tymchuk - Senior Technical Editor. Genebase Systems. 2008. Archived from the original on 2010-06-22. Retrieved 2009-11-21.


  136. ^ Bortolini MC, Salzano FM, Thomas MG, et al. (September 2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas" (PDF). Am. J. Hum. Genet. 73 (3): 524–39. doi:10.1086/377588. PMC 1180678. PMID 12900798.


  137. ^ Shen, Peidong; Lavi, Tal; Kivisild, Toomas; Chou, Vivian; Sengun, Deniz; Gefel, Dov; Shpirer, Issac; Woolf, Eilon; et al. (2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-Chromosome and mitochondrial DNA sequence Variation". Human Mutation. 24 (3): 248–60. doi:10.1002/humu.20077. PMID 15300852. Q-M323 in 3/20=15% of a sample of Yemenite Jews.


  138. ^ Zhong, H.; Shi, H.; Qi, X.-B.; Duan, Z.-Y.; Tan, P.-P.; Jin, L.; Su, B.; Ma, R. Z. (2010). "Extended Y Chromosome Investigation Suggests Postglacial Migrations of Modern Humans into East Asia via the Northern Route". Molecular Biology and Evolution. 28 (1): 717–27. doi:10.1093/molbev/msq247. PMID 20837606.


  139. ^ Adams, S. M.; Bosch, E.; Balaresque, P. L.; Ballereau, S. J.; Lee, A. C.; Arroyo, E.; López-Parra, A. M.; Aler, M.; et al. (2008). "The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula". Am J Hum Genet. 83 (6): 725–736. doi:10.1016/j.ajhg.2008.11.007. PMC 2668061. PMID 19061982.


  140. ^ The First Peopling of South America: New Evidence from Y-Chromosome Haplogroup Q Vincenza Battaglia, Viola Grugni, Ugo Alessandro Perego, Norman Angerhofer, J. Edgar Gomez-Palmieri, Scott Ray Woodward, Alessandro Achilli, Natalie Myres, Antonio Torroni, Ornella Semino


  141. ^ YFull - Experimental Y Tree, Y-SNP calls for Afontova Gora 2, Afantova had haplogroup Q1a1 and some type of R derived mtdna.


  142. ^ Rasmussen, M.; Anzick, S.; et al. (February 2014). "The genome of a Late Pleistocene human from a Clovis burial site in western Montana". Nature. 506 (7487): 225–229. doi:10.1038/nature13025. PMC 4878442. PMID 24522598.


  143. ^ Jennifer A. Raff & Deborah A. Bolnick. Palaeogenomics: Genetic roots of the first Americans // Nature. 2014. V. 506. P. 162–163.


  144. ^ The ancestry and affiliations of Kennewick Man


  145. ^ Hollard et al., Strong genetic admixture in the Altai at the Middle Bronze Age revealed by uniparental and ancestry informative makers, Forensic Science International: Genetics, published online 4 June 2014


  146. ^ "Q-YP1500 YTree".


  147. ^ Rasmussen, M.; et al. (2010). "Ancient human gonome sequence of an extinct Palaeo-Eskimo". Nature. 463 (7282): 757–762. doi:10.1038/nature08835. PMC 3951495. PMID 20148029.


  148. ^ ab On Henbei, Pengyang, and Heigouliang, Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China (2012)


  149. ^ Yong-Bin Zhao et al., Ancient DNA evidence reveals that the Y chromosome haplogroup Q1a1 admixture into the Han Chinese 3,000 years ago, American Journal of Human Biology (Aug 2014).


  150. ^ Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China (2012)


  151. ^ L. L. Kang et al., Y chromosomes of ancient Hunnu people and its implication on the phylogeny of East Asian linguistic families (2013)


  152. ^ Knowing the Xiongnu Culture in Eastern Tianshan Mountain from Tomb Heigouliang and Dongheigou Site at the Beginning of Xihan Dynasty, RenMeng, WangJianXin, 2008


  153. ^ Qui, Y; et al. (2015). "Identification of kinship and occupant status in Mongolian noble burials of the Yuan dynasty through a multidisciplinary approach". Phil. Trans. R. Soc. B370 (1660): 20130378. doi:10.1098/rstb.2013.0378. PMC 4275886. PMID 25487330.




Bibliography





  • Abu-Amero, Khaled K; Hellani, Ali; González, Ana M; Larruga, Jose M; Cabrera, Vicente M; Underhill, Peter A (2009). "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions". BMC Genetics. 10 (1): 59. doi:10.1186/1471-2156-10-59. PMC 2759955. PMID 19772609.


  • Behar, Doron M.; Garrigan, Daniel; Kaplan, Matthew E.; Mobasher, Zahra; Rosengarten, Dror; Karafet, Tatiana M.; Quintana-Murci, Lluis; Ostrer, Harry; et al. (2004). "Contrasting patterns of Y chromosome variation in Ashkenazi Jewish and host non-Jewish European populations". Human Genetics. 114 (4): 354–65. doi:10.1007/s00439-003-1073-7. PMID 14740294.


  • Bortolini, M; Salzano, F; Thomas, M; Stuart, S; Nasanen, S; Bau, C; Hutz, M; Layrisse, Z; et al. (2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas". The American Journal of Human Genetics. 73 (3): 524–39. doi:10.1086/377588. PMC 1180678. PMID 12900798.


  • Cadenas, Alicia M; Zhivotovsky, Lev A; Cavalli-Sforza, Luca L; Underhill, Peter A; Herrera, Rene J (2007). "Y-chromosome diversity characterizes the Gulf of Oman". European Journal of Human Genetics. 16 (3): 374–86. doi:10.1038/sj.ejhg.5201934. PMID 17928816.*Cadenas, Alicia M; Zhivotovsky, Lev A; Cavalli-Sforza, Luca L; Underhill, Peter A; Herrera, Rene J (2007). "Y-chromosome diversity characterizes the Gulf of Oman". European Journal of Human Genetics. 16 (3): 374–86. doi:10.1038/sj.ejhg.5201934. PMID 17928816.


  • Cinnioglu, Cengiz; King, Roy; Kivisild, Toomas; Kalfoglu, Ersi; Atasoy, Sevil; Cavalleri, Gianpiero L.; Lillie, Anita S.; Roseman, Charles C.; et al. (2004). "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639.


  • Firasat, Sadaf; Khaliq, Shagufta; Mohyuddin, Aisha; Papaioannou, Myrto; Tyler-Smith, Chris; Underhill, Peter A; Ayub, Qasim (2006). "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan". European Journal of Human Genetics. 15 (1): 121–6. doi:10.1038/sj.ejhg.5201726. PMC 2588664. PMID 17047675.


  • Gayden, T; Cadenas, AM; Regueiro, M; Singh, NB; Zhivotovsky, LA; Underhill, PA; Cavalli-Sforza, LL; Herrera, RJ (2007). "The Himalayas as a Directional Barrier to Gene Flow". The American Journal of Human Genetics. 80 (5): 884–94. doi:10.1086/516757. PMC 1852741. PMID 17436243.


  • Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; Omoto, Keiichi; Harihara, Shinji; Stoneking, Mark; Horai, Satoshi (2005). "Dual origins of the Japanese* common ground for hunter-gatherer and farmer Y chromosomes". Journal of Human Genetics. 51 (1): 47–58. doi:10.1007/s10038-005-0322-0. PMID 16328082.


  • Mirabal, Sheyla; Regueiro, Maria; Cadenas, Alicia M; Cavalli-Sforza, L Luca; Underhill, Peter A; Verbenko, Dmitry A; Limborska, Svetlana A; Herrera, Rene J (2009). "Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia". European Journal of Human Genetics. 17 (10): 1260–73. doi:10.1038/ejhg.2009.6. PMC 2986641. PMID 19259129.


  • Nonaka, I.; Minaguchi, K.; Takezaki, N. (2007). "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms". Annals of Human Genetics. 71 (Pt 4): 480–95. doi:10.1111/j.1469-1809.2006.00343.x. PMID 17274803.


  • Pakendorf, Brigitte; Novgorodov, Innokentij N.; Osakovskij, Vladimir L.; Danilova, Al’Bina P.; Protod’jakonov, Artur P.; Stoneking, Mark (2006). "Investigating the effects of prehistoric migrations in Siberia* genetic variation and the origins of Yakuts". Human Genetics. 120 (3): 334–53. doi:10.1007/s00439-006-0213-2. PMID 16845541.


  • Rasmussen, Morten; Li, Yingrui; Lindgreen, Stinus; Pedersen, Jakob Skou; Albrechtsen, Anders; Moltke, Ida; Metspalu, Mait; Metspalu, Ene; et al. (2010). "Ancient human genome sequence of an extinct Palaeo-Eskimo". Nature. 463 (7282): 757–62. doi:10.1038/nature08835. PMC 3951495. PMID 20148029.


  • Regueiro, M.; Cadenas, A.M.; Gayden, T.; Underhill, P.A.; Herrera, R.J. (2006). "Iran* Tricontinental Nexus for Y-Chromosome Driven Migration". Human Heredity. 61 (3): 132–43. doi:10.1159/000093774. PMID 16770078.


  • Sengupta, S; Zhivotovsky, L; King, R; Mehdi, S; Edmonds, C; Chow, C; Lin, A; Mitra, M; et al. (2006). "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists". The American Journal of Human Genetics. 78 (2): 202–21. doi:10.1086/499411. PMC 1380230. PMID 16400607.


  • Sharma, Swarkar; Rai, Ekta; Bhat, Audesh K; Bhanwer, Amarjit S; Bamezai, Rameshwar NK (2007). "A novel subgroup Q5 of human Y-chromosomal haplogroup Q in India". BMC Evolutionary Biology. 7 (1): 232. doi:10.1186/1471-2148-7-232. PMC 2258157. PMID 18021436.


  • Shen, Peidong; Lavi, Tal; Kivisild, Toomas; Chou, Vivian; Sengun, Deniz; Gefel, Dov; Shpirer, Issac; Woolf, Eilon; et al. (2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-Chromosome and mitochondrial DNA sequence Variation". Human Mutation. 24 (3): 248–60. doi:10.1002/humu.20077. PMID 15300852.


  • Wells, Spencer (2002). The Journey of Man* A Genetic Odyssey. Random House. ISBN 978-0-8129-7146-0.


  • Wells, R. S.; Yuldasheva, N; Ruzibakiev, R; Underhill, PA; Evseeva, I; Blue-Smith, J; Jin, L; Su, B; et al. (2001). "The Eurasian Heartland: A continental perspective on Y-chromosome diversity". Proceedings of the National Academy of Sciences. 98 (18): 10244–9. doi:10.1073/pnas.171305098. PMC 56946. PMID 11526236.


  • Wen, Bo; Li, Hui; Lu, Daru; Song, Xiufeng; Zhang, Feng; He, Yungang; Li, Feng; Gao, Yang; et al. (2004). "Genetic evidence supports demic diffusion of Han culture". Nature. 431 (7006): 302–5. doi:10.1038/nature02878. PMID 15372031.


  • Su, Bing; Xiao, Chunjie; Deka, Ranjan; Seielstad, Mark T.; Kangwanpong, Daoroong; Xiao, Junhua; Lu, Daru; Underhill, Peter; et al. (2000). "Y chromosome haplotypes reveal prehistorical migrations to the Himalayas". Human Genetics. 107 (6): 582–90. doi:10.1007/s004390000406. PMID 11153912.


  • Zalloua, P; Xue, Y; Khalife, J; Makhoul, N; Debiane, L; Platt, D; Royyuru, A; Herrera, R; et al. (2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". The American Journal of Human Genetics. 82 (4): 873–82. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297.


  • Zegura, S. L.; Karafet, TM; Zhivotovsky, LA; Hammer, MF (2003). "High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas". Molecular Biology and Evolution. 21 (1): 164–75. doi:10.1093/molbev/msh009. PMID 14595095.


  • Wells, Spencer (2002). The Journey of Man: A Genetic Odyssey. Random House LLC. ISBN 978-0-8129-7146-0. LCCN 2003066679. Retrieved May 13, 2014.


  • Gokcumen, Omer (2008). Ethnohistorical and Genetic Survey of Four Central Anatolian Settlements. University of Pennsylvania. ISBN 978-0-549-80966-1. Retrieved May 13, 2014.




External links








  • Spread of Haplogroup Q, from The Genographic Project, National Geographic

  • The India Genealogical DNA Project

  • British Isles DNA Project




Popular posts from this blog

How to pass form data using jquery Ajax to insert data in database?

National Museum of Racing and Hall of Fame

Firestore DeadlineExceeded exception for big collections